Analytical Data
-
Gene name
PLK1
- Application
-
Alternative Names
PLK1;PLK;Serine/threonine-Protein kinase PLK1
-
Species
Human
-
Source
E. coli
-
Tag
N-terminal His Tag
-
Purity
Greater than 90% as determined by SDS-PAGE.
-
Uniprot
P53350
-
Expression Region
410-488aa
-
AA Sequence
TGGGTCAGCAAGTGGGTGGACTATTCGGACAAGTACGGCCTTGGGTATCAGC TCTGTGATAACAGCGTGGGGGTGCTCTTCAATGACTCAACACGCCTCATCCT CTACAATGATGGTGACAGCCTGCAGTACATAGAGCGTGACGGCACTGAGTCC TACCTCACCGTGAGTTCCCATCCCAACTCCTTGATGAAGAAGATCACCCTCC TTAAATATTTCCGCAATTACATGAGCGAGtgataa
-
Molecular Weight
13kDa
-
Endotoxin
< 1.0 EU per μg protein as determined by the LAL method.
-
Form
Freeze-dried powder
-
Buffer formulation
PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
-
Reconstitution
Reconstitute in ddH2O to a concentration of 0.1-0.5 mg/mL. Do not vortex.
- Customization
-
Stability Test
The thermal stability is described by the loss rate. The loss rate was determined by accelerated thermal degradation test, that is, incubate the protein at 37℃ for 48h, and no obvious degradation and precipitation were observed. The loss rate isless than 8% within the expiration date under appropriate storage condition.
-
Storage & Shelf Life
Samples are stable for up to twelve months from date of receipt at -20℃ to -80℃. Store it under sterile conditions at -20℃ to -80℃. It is recommended that the protein be aliquoted for optimal storage. Avoid repeated freeze-thaw cycles.
-
Shipping
In general, recombinant proteins are supplied as lyophilized powder and shipped at ambient temperature. For bulk packages, the proteins are provided as frozen liquid and shipped with blue ice, unless otherwise requested by the customer.
Quality inspection process
Related Products
Identification
Protein Description
PLK1 (Polo-like kinase 1) is a pivotal serine/threonine kinase that plays a crucial role in the regulation of cell cycle progression, particularly during mitosis. As a member of the polo-like kinase family, PLK1 is essential for various cellular processes, including centrosome maturation, spindle assembly, and chromosome segregation. Dysregulation of PLK1 has been implicated in several cancers, making it a promising target for therapeutic interventions. The study of recombinant PLK1 protein is vital for understanding its structure-function relationship and regulatory mechanisms in the cell cycle. Recombinant techniques allow researchers to produce PLK1 in sufficient quantities and purity for biochemical assays, structural biology studies, and drug development. By investigating PLK1's interactions with various substrates and inhibitors, scientists can elucidate its role in oncogenesis and identify potential pharmacological agents that selectively inhibit its activity. The ongoing development of PLK1 inhibitors is therefore a significant area of research in cancer therapy, as targeting this kinase could lead to the development of novel treatments that improve patient outcomes. Understanding PLK1 through recombinant protein studies not only enhances our knowledge of cell cycle regulation but also opens avenues for innovative cancer therapies.











